Biopython-corba How-To
Brad Chapman (chapmanb@arches.uga.edu)
Last Update--23 September 2001
1 Introduction
This tutorial is designed to get you up and running quickly with
biopython-corba. Biopython-corba does all of the following good stuff:
-
Provides a complete implementation of the BioCorba
(http://www.biocorba.org) specification that allows
interoperation between the different bio projects (biopython,
bioperl, biojava). This specification is currently merging with the
Life Science Research groups' spec, called BSANE
(http://industry.ebi.ac.uk/~muilu/OMG/BSANE/index.html),
so it is even more standard (and thus useful!).
- Provides a biopython-like set of interfaces on top of the
BioCorba specification, so that using biopython-corba is a lot like
using biopython (less to learn, easier to get started!).
- Works interchangably with three different python ORB
implementations (omniORBpy, ORBit-python and Fnorb), allowing
you to switch ORBs just by changing a line of text in the
configuration file.
- Makes it easy to get standard biopython objects ''CORBA-ready,''
so that little work is required to make your biopython code usable as
a CORBA server.
- Provides all the standard good stuff that comes with CORBA:
position and language independent code (connect easily across a
network; talk between Perl and Python and Java).
2 Installation
2.1 Requirements
In order to use biopython-corba, you need to install Biopython and
a CORBA ORB implementation.
Biopython is available from (http://www.biopython.org).
Currently, you need a current version of CVS to run biopython-corba,
which you can check out with instructions from
http://cvs.biopython.org. Once a new release becomes
after 1.00a3 becomes available, you can get one of those from the
standard Download place
(http://www.biopython.org/Download/).
You will also need an ORB implementation. Currently you can choose from
one of the following:
-
omniORB - Python bindings are available from
http://www.uk.research.att.com/omniORB/omniORBpy/
and omniORB itself is available from
http://www.uk.research.att.com/omniORB/index.html.
omniORBpy is an excellent python ORB under continuous development. It
is quite fast and interoperable. It is quite a large C++ program
though, so it can take some effort and time to install.
- ORBit and ORBit-python -- ORBit
(http://orbit-resource.sourceforge.net/) is the
standard ORB for the Gnome project. If you run Gnome or a standard
Linux distribution, it may already be installed. Try typing
orbit-config --version. If you get back something like ORBit
0.5.8, then it's already installed and you just need the ORBit-python
bindings, available from
http://orbit-python.sault.org/. Currently, you need a
CVS version of ORBit-python but 0.3.1 or later should work with
biopython-corba.
An addtional item that needs to be done is to get ORBit working
in an interoperable manner. To do this, you need to create a
.orbitrc file in your home directory with the line:
ORBIIOPIPv4=1 in it.
- Fnorb -- Fnorb is an ORB implementation written almost entirely
in python, and is available from http://www.fnorb.org/.
It is slower than the other ORBs, but is relatively easy to install
since it is all python. One catch is that Fnorb needs some patches to
work with biopython-corba and with python versions later than 2.0. You
will need to get and apply the patch at
http://bioinformatics.org/bradstuff/bc/fnorb.patch
for everything to work happily.
2.2 Getting biopython-corba installed
Now that you've got the requirements installed, we're ready to get this
installed. Here we go:
-
Get biopython-corba, which is available by anonymous cvs at
biopython (see http://cvs.biopython.orgfor
instructions), or via download at
http://www.biopython.org/Download/. Presumedly you
already have this though, if you are reading this :)
- Edit the configuration file. This file is located in
BioCorba/biocorbaconfig.py, and contains the options available for
building and using biopython-corba. Basically, you will just want to
edit the variable
orb_implementation to match the python ORB
implementation you installed above.
- Change into the main biopython-corba directory and excecute, as
root, the command
python setup.py install. This will do all the
necessary magic and install everything.
2.3 Testing the installation
There are a number of tests available in the Tests directory. This
describes how to run 'em. Feel free to keep running them until you are
satisfied that everything installed smoothly.
-
Unittests -- There are several modules which test individual
parts of the libraries. You can run these tests simply with:
python test_Sequences.py, python test_Features.py,
python test_Collections.py and
python test_PythonBioInterfaces.py. If these work you should
see a lot of 'ok's printed, and no error messages.
- Complete Server tests -- There are also more ''real-life'' tests
available for a python server. First, you need to start up the server,
so change to the
Scripts directory and run
python collections_server.py. Now, in a different xterm window,
run the test: python test_PythonServers.py. You should see a
whole lot of output produced and no errors.
3 Getting Started
This section is designed to get you up and running quickly with
biopython-corba. After reading this section, the goals are that you should:
-
know how to make a Biopython Dictionary object (like a GenBank file)
available as a python server
- Understand how to use a biopython-corba client to connect to a
Dictionary-like object and deal with it.
This section assumes some basic familiarity with biopython and CORBA.
3.1 Setting up a BioCorba server from a Biopython Dictionary
The big advantage of the biopython-corba libraries are that they make it
easy to take a biopython object and make it available through CORBA.
This example shows how to take GenBank information represented as a
Biopython Dictionary object, and turn it into a BioCorba
BioSequenceCollection.
3.1.1 Setting up the biopython Dictionary
First, we need to create a Biopython Dictionary. Biopython Dictionary
objects act like standard python dictionaries,
except that they provide biological information. In this example, we are
going to create a dictionary to a GenBank file of drought related
proteins in Arabidopsis.
We do this in the exact same way it is done in biopython. First we index
the GenBank file, then we set up a dictionary that will return
SeqRecord objects for each GenBank item in the dictionary:
from Bio import GenBank
gb_file = "a_drought.gb"
index_file = "a_drought.idx"
GenBank.index_file(gb_file, index_file)
feature_parser = GenBank.FeatureParser()
gb_dictionary = GenBank.Dictionary(index_file, feature_parser)
Now we've got a dictionary that is ready to be fed into a BioCorba
server.
3.1.2 Making the Dictionary a BioCorba server
The biopython-corba server code does all of the hard work of taking the
dictionary you give it and making it follow the BioCorba standards. All
you need to do is follow the right way of presenting your objects. In
BioCorba the standard database-like object is called a
BioSequenceCollection. You can give a
BioSequenceCollection any Dictionary-like object from Biopython
(ie. Fasta dictionaries, etc) or any object of your own that behaves
like a Dictionary (implements __getitem__ and keys).
We give BioSequenceCollection our Dictionary object, the
name of the database, a version and the description, and it does the
rest.
Next, we need to make a reference to the
server available. This reference is analagous to a web URL, except it is
more complicated because it needs to specify the entire path to get to
the host, port and object itself. In CORBA these references are called
Interoperable Object References (IORs). In this example, we will write
a stringified version of the IOR for the server to a file so a client
can get it. In real life, you might put this IOR on a web site,
e-mail it to a collaborator, or somehow get it to someone else.
Once the reference to the server is written out, all we need to do is get
the server running so it can sit and wait for clients to connect to it.
Whew, all that seemed like a lot of work, but the following small amount
of code will get it done:
from BioCorba.Server.Seqcore.CorbaCollection import BioSequenceCollection
server = BioSequenceCollection(gb_dictionary, "Arabidopsis Drought Database",
1.0, "Putative Drought Resistance Genes in Arabidopsis")
print "Writing IOR to a file and starting the server..."
server.string_ior_to_file("a_drought.ior")
server.run()
Whoo hoo -- with just this little bit of code we've taken a GenBank file
and made it available through the BioCorba interface. With the server
you've set up, people can write code in any language to attach to this
server and retrieve the information out of it. Isn't CORBA a great
thing?
3.2 Using a BioCorba client though a Biopython-like interface
This section describes retrieving information through BioCorba. The
recommended method to use the biopython-corba interfaces is through the
Bio-like interfaces, which emulate the biopython interfaces. It's better
to write your code against these interfaces for a couple of reasons.
First, they're easier to learn since they resemble, as close as
possible, biopython code. Second, these APIs will be more stable between
biopython-corba releases. The underlying BioCorba interfaces are likely
to change, and this has been especially true as we've been working to
get the CORBA interfaces "right."
We'll demonstrate how to take a BioCorba BioSequenceCollection
server and get information from it through a GenBank-like interface.
This will show retrieving SeqRecord objects from a Dictionary-like
interface, and getting features on these SeqRecords.
3.2.1 Getting the BioCorba server and connecting to it
The trickiest part of learning how to use BioCorba is understanding how
to connect to a server. The biopython-corba interfaces try to make this
job easier by makine it involve only 2 steps:
-
Get a ``loader`` object that can be used to get connections with
servers of a specific type. In our case, we are going to be creating a
loader that will give us a
BioSequenceCollection from a python
based server.
- Use the ``loader`` object to get a client connection from a
server, based on a server reference. As we mentioned before, the
reference to a server is called an IOR, and can be located in a number
of possible places (ie. web site, file). In this case we'll be
connecting to our server from a reference in a file.
Now that we've said all of that, the code to get a client reference to a
BioSequenceCollection should (hopefully) make sense:
from BioCorba.Client.BiocorbaConnect import PythonCorbaClient
from BioCorba.Client.Seqcore.CorbaCollection import BioSequenceCollection
ior_file = 'a_drought.ior'
client_loader = PythonCorbaClient(BioSequenceCollection)
client = client_loader.from_file_ior(ior_file)
Now we've got a BioSequenceCollection client connected to a
server. This client uses the raw BioCorba interfaces, but we'd like to
be able to use the Biopython-like interfaces. To do this, we will load
up a GenBank Dictionary object in much the same way we do in the
Biopython. The major difference is that instead of using a file handle
to a GenBank file we will use our connected client. So, we can just
think of the client/server connection as a way to get info out of a
GenBank file. The code to get the GenBank dictionary should hopefully
look familiar (except that the imports come from BioCorba.Bio instead of
just Bio):
from BioCorba.Bio import GenBank
feature_parser = GenBank.FeatureParser()
gb_dict = GenBank.Dictionary(client, feature_parser)
Whoo hoo, now we've got our Biopython-like GenBank dictionary. As we'll
see in the next section, we can use this exactly like we would a normal
Biopython Dictionary object.
3.2.2 Using the Biopython-like interface
Now that we've got our GenBank-like object, we are ready to use it
exactly like we would any Dictionary object from Biopython. We don't
need to worry about CORBA or anything at all. The following example
code, which should be familiar to anyone using the standard SeqRecord
and SeqFeature objects from Biopython, will just look at the available
accessions in the database, and then retrieve a record and look at it:
accessions = gb_dict.keys()
print "Accessions:", accessions
seq_record = gb_dict['BE038456']
print "name:", seq_record.name
print "id:", seq_record.id
print "description:", seq_record.description
print "First 50 bases:", seq_record.seq[:50]
print "First SeqFeature:"
print "\tType:", seq_record.features[0].type
print "\tLocation:", seq_record.features[0].location
print "\tQualifiers:", seq_record.features[0].qualifiers
This produces the following output:
ccessions: ['BE038008', 'BE038108', 'BE038455', 'BE038456', 'BE038835',
'BE844799']
name: BE038456
id: BE038456.1
description: AA17G06 AA Arabidopsis thaliana cDNA 5' similar to
drought-induced protein di19, mRNA sequence.
First 50 bases:
Seq('GCACGAGCTTCTTCTTCATCTATTCAGGATCGATCCGGCTTGAGATTTAT', RNAAlphabet())
First SeqFeature:
Type: source
Location: (0..708)
Qualifiers: {'clone_lib': ['AA'], 'organism': ['Arabidopsis thaliana'],
'dev_stage': ['12 weeks'], 'cultivar': ['Columbia'],
'tissue_type': ['leaves, flowering plants'],
'db_xref': ['taxon:3702'], 'note': ['20 h 200mM NaCl']}
Nice. Now we're set up for both creating server objects and accessing
them through a Biopython-like interface. Hopefully this Tutorial gave
enough instruction to get you started exploring this further.
4 Other Useful Information
4.1 Learning more about Python and CORBA
Alan Robinson has written a very nice introduction to writing CORBA
clients, which has a path on python. You can check this out on line at
http://industry.ebi.ac.uk/~alan/CORBA/. The python
section is also available in the Doc directory in pdf as
IntroPythonClient.pdf.
I also wrote a similar paper which is meant as an introduction to
writing python servers. It is available in the Doc directory in pdf
format in the file IntroPythonServer.pdf.
4.2 The Standard Python Mapping
The mapping of IDL to python has been standardized, and
documentation describing this official mapping is available
(http://www.omg.org/cgi-bin/doc?ptc/00-04-08). Due to
recent acceptance of this standard, the degree to which different
python ORB implementations follow it vary, unfortunately. The
biopython-corba package attempts to standardize "non-compliant" ORB
implementations so that they can be used through the same interface. This makes it possible to use any supported ORB with the biopython-corba interfaces without needed to change any code.
This document was translated from LATEX by
HEVEA.