Package Bio :: Package Motif
[hide private]
[frames] | no frames]

Package Motif

source code

Tools for sequence motif analysis (DEPRECATED, see Bio.motifs instead).

This module (Bio.Motif) has been deprecated and will be removed in a
future release of release of Biopython. Please use the new module
Bio.motifs instead.

This contains the core Motif class containing various I/O methods as
well as methods for motif comparisons and motif searching in sequences.
It also inlcudes functionality for parsing AlignACE and MEME programs.

Submodules [hide private]

Functions [hide private]
 
_from_pfm(handle) source code
 
_from_sites(handle) source code
 
parse(handle, format)
Parses an output file of motif finding programs.
source code
 
read(handle, format)
Reads a motif from a handle using a specified file-format.
source code
Variables [hide private]
  _parsers = {"AlignAce": _AlignAce_read, "MEME": _MEME_read,}
  _readers = {"jaspar-pfm": _from_pfm, "jaspar-sites": _from_sites}
  __package__ = 'Bio.Motif'
  __warningregistry__ = {('The module Bio.Motif has been depreca...
Function Details [hide private]

parse(handle, format)

source code 
Parses an output file of motif finding programs.

Currently supported formats:
 - AlignAce
 - MEME

You can also use single-motif formats, although the Bio.Motif.read()
function is simpler to use in this situation.
 - jaspar-pfm
 - jaspar-sites

For example:

>>> from Bio import Motif
>>> with open("Motif/alignace.out") as handle:
...     for motif in Motif.parse(handle, "AlignAce"):
...         print(motif.consensus())
...
TCTACGATTGAG
CTGCACCTAGCTACGAGTGAG
GTGCCCTAAGCATACTAGGCG
GCCACTAGCAGAGCAGGGGGC
CGACTCAGAGGTT
CCACGCTAAGAGAAGTGCCGGAG
GCACGTCCCTGAGCA
GTCCATCGCAAAGCGTGGGGC
GAGATCAGAGGGCCG
TGGACGCGGGG
GACCAGAGCCTCGCATGGGGG
AGCGCGCGTG
GCCGGTTGCTGTTCATTAGG
ACCGACGGCAGCTAAAAGGG
GACGCCGGGGAT
CGACTCGCGCTTACAAGG

read(handle, format)

source code 
Reads a motif from a handle using a specified file-format.

This supports the same formats as Bio.Motif.parse(), but
only for files containing exactly one record.  For example,
reading a pfm file:

>>> from Bio import Motif
>>> with open("Motif/SRF.pfm") as handle:
...     motif = Motif.read(handle, "jaspar-pfm")
...
>>> motif.consensus()
Seq('GCCCATATATGG', IUPACUnambiguousDNA())

Or a single-motif MEME file,

>>> from Bio import Motif
>>> with open("Motif/meme.out") as handle:
...     motif =  Motif.read(handle, "MEME")
...
>>> motif.consensus()
Seq('CTCAATCGTA', IUPACUnambiguousDNA())

If the handle contains no records, or more than one record,
an exception is raised:

>>> from Bio import Motif
>>> with open("Motif/alignace.out") as handle:
...     motif = Motif.read(handle, "AlignAce")
...
Traceback (most recent call last):
    ...
ValueError: More than one motif found in handle

If however you want the first record from a file containing
multiple records this function would raise an exception (as
shown in the example above).  Instead use:

>>> from Bio import Motif
>>> with open("Motif/alignace.out") as handle:
...    motif = next(Motif.parse(handle, "AlignAce"))
...
>>> motif.consensus()
Seq('TCTACGATTGAG', IUPACUnambiguousDNA())

Use the Bio.Motif.parse(handle, format) function if you want
to read multiple records from the handle.


Variables Details [hide private]

__warningregistry__

Value:
{('The module Bio.Motif has been deprecated and will be removed in a f\
uture release of Biopython. Instead please use the new module Bio.moti\
fs instead. Please be aware that though the functionality of Bio.Motif\
 is retained (and extended) in Bio.motifs, usage may be different.',
  <class 'Bio.BiopythonDeprecationWarning'>,
  26): True}