Seq
m (→Nucleotide methods: Version note) |
|||
| (3 intermediate revisions by 3 users not shown) | |||
| Line 1: | Line 1: | ||
| − | + | In Biopython, sequences are usually held as '''Seq''' objects, which hold the sequence string and an associated alphabet. | |
| − | + | ||
| − | + | This page describes the Biopython '''Seq''' object, defined in the Bio.Seq module (together with related objects like the '''MutableSeq''', plus some general purpose sequence functions). | |
| + | In addition to this wiki page, there is a whole chapter in the [http://biopython.org/DIST/docs/tutorial/Tutorial.html Tutorial] ([http://biopython.org/DIST/docs/tutorial/Tutorial.pdf PDF]) on the '''Seq''' object - plus its [http://biopython.org/DIST/docs/api/Bio.Seq.Seq-class.html API documentation] (which you can read online, or from within Python with the help command). | ||
| − | If you need to store additional information like a sequence | + | If you need to store additional information like a sequence identifier or name, or even more details like a description or annotation, then we use a [[SeqRecord]] object instead. These are the sequence records used by the [[SeqIO]] module for reading and writing sequence files. |
= The Seq Object = | = The Seq Object = | ||
| Line 127: | Line 127: | ||
The chapter in the [http://biopython.org/DIST/docs/tutorial/Tutorial.html Tutorial] ([http://biopython.org/DIST/docs/tutorial/Tutorial.pdf PDF]) goes into more detail on this strand issue. | The chapter in the [http://biopython.org/DIST/docs/tutorial/Tutorial.html Tutorial] ([http://biopython.org/DIST/docs/tutorial/Tutorial.pdf PDF]) goes into more detail on this strand issue. | ||
| + | [[Category:Wiki Documentation]] | ||
=== Translation === | === Translation === | ||
Latest revision as of 10:46, 24 March 2010
In Biopython, sequences are usually held as Seq objects, which hold the sequence string and an associated alphabet.
This page describes the Biopython Seq object, defined in the Bio.Seq module (together with related objects like the MutableSeq, plus some general purpose sequence functions). In addition to this wiki page, there is a whole chapter in the Tutorial (PDF) on the Seq object - plus its API documentation (which you can read online, or from within Python with the help command).
If you need to store additional information like a sequence identifier or name, or even more details like a description or annotation, then we use a SeqRecord object instead. These are the sequence records used by the SeqIO module for reading and writing sequence files.
Contents |
The Seq Object
The Seq object essentially combines a Python string with an (optional) biological alphabet. For example:
>>> from Bio.Seq import Seq >>> my_seq = Seq("AGTACACTGGT") >>> my_seq Seq('AGTACACTGGT', Alphabet()) >>> my_seq.alphabet Alphabet()
In the above example, we haven't specified an alphabet so we end up with a default generic alphabet. Biopython doesn't know if this is a nucleotide sequence or a protein rich in alanines, glycines, cysteines and threonines. If you know, you should supply this information:
>>> from Bio.Seq import Seq >>> from Bio.Alphabet import generic_dna, generic_protein >>> my_seq = Seq("AGTACACTGGT") >>> my_seq Seq('AGTACACTGGT', Alphabet()) >>> my_dna = Seq("AGTACACTGGT", generic_dna) >>> my_dna Seq('AGTACACTGGT', DNAAlphabet()) >>> my_protein = Seq("AGTACACTGGT", generic_protein) >>> my_protein Seq('AGTACACTGGT', ProteinAlphabet())
Why is this important? Well it can catch some errors for you - you wouldn't want to accidentally try and combine a DNA sequence with a protein would you:
>>> my_protein + my_dna Traceback (most recent call last): ... TypeError: Incompatable alphabets ProteinAlphabet() and DNAAlphabet()
Biopython will also catch things like trying to use nucleotide only methods like translation (see below) on a protein sequence.
General methods
The Seq object has a number of methods which act just like those of a Python string, for example the find method:
>>> from Bio.Seq import Seq >>> from Bio.Alphabet import generic_dna >>> my_dna = Seq("AGTACACTGGT", generic_dna) >>> my_dna Seq('AGTACACTGGT', DNAAlphabet()) >>> my_dna.find("ACT") 5 >>> my_dna.find("TAG") -1
There is a count method too:
>>> my_dna.count("A") 3 >>> my_dna.count("ACT") 1
However, watch out because just like the Python string's count, this is a non-overlapping count!
>>> "AAAA".count("AA") 2 >>> Seq("AAAA", generic_dna).count("AA") 2
In some biological situations, you might prefer an overlapping count which would give three for this example.
Nucleotide methods
If you have a nucleotide sequence (or a sequence with a generic alphabet) you may want to do things like take the reverse complement, or do a translation. Note some of these methods described here are only available in Biopython 1.49 onwards.
Complement and reverse complement
These are very simple - the methods return a new Seq object with the appropriate sequence and the same alphabet:
>>> from Bio.Seq import Seq >>> from Bio.Alphabet import generic_dna >>> my_dna = Seq("AGTACACTGGT", generic_dna) >>> my_dna Seq('AGTACACTGGT', DNAAlphabet()) >>> my_dna.complement() Seq('TCATGTGACCA', DNAAlphabet()) >>> my_dna.reverse_complement() Seq('ACCAGTGTACT', DNAAlphabet())
Transcription and back transcription
If you have a DNA sequence, you may want to turn it into RNA. In bioinformatics we normally assume the DNA is the coding strand (not the template strand) so this is a simple matter of replacing all the thymines with uracil:
>>> my_dna Seq('AGTACACTGGT', DNAAlphabet()) >>> my_dna.transcribe() Seq('AGUACACUGGU', RNAAlphabet())
Naturally, given some RNA, you might want the associated DNA - and again Biopython does a simple U/T substitution:
>>> my_rna = my_dna.transcribe() >>> my_rna Seq('AGUACACUGGU', RNAAlphabet()) >>> my_rna.back_transcribe() Seq('AGTACACTGGT', DNAAlphabet())
If you actually do want the template strand, you'd have to do a reverse complement on top:
>>> my_rna Seq('AGUACACUGGU', RNAAlphabet()) >>> my_rna.back_transcribe().reverse_complement() Seq('ACCAGTGTACT', DNAAlphabet())
The chapter in the Tutorial (PDF) goes into more detail on this strand issue.
Translation
You can translate RNA:
>>> from Bio.Seq import Seq >>> from Bio.Alphabet import generic_rna >>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG", generic_rna) >>> messenger_rna.translate() Seq('MAIVMGR*KGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
Or DNA - which is assumed to be the coding strand:
>>> from Bio.Seq import Seq >>> from Bio.Alphabet import generic_dna >>> coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", generic_dna) >>> coding_dna.translate() Seq('MAIVMGR*KGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
In either case there are several useful options - by default as you will notice the in example above translation continues through any stop codons, but this is optional:
>>> coding_dna.translate(to_stop=True) Seq('MAIVMGR', ExtendedIUPACProtein())
Then there is the translation table, for which you can give an NCBI genetic code number or name:
>>> coding_dna.translate(table=2) Seq('MAIVMGRWKGAR*', HasStopCodon(ExtendedIUPACProtein(), '*')) >>> coding_dna.translate(table="Vertebrate Mitochondrial") Seq('MAIVMGRWKGAR*', HasStopCodon(ExtendedIUPACProtein(), '*'))
You can of course combine these options:
>>> coding_dna.translate(table=2, to_stop=True) Seq('MAIVMGRWKGAR', ExtendedIUPACProtein())
Consult the tutorial for more examples and arguments (e.g. specifying a different symbol for a stop codon), or see the built in help:
>>> help(coding_dna.translate) ...
Using nucleotide methods on a protein
None of this operations apply to a protein sequence and trying this will raise an exception:
>>> my_protein.complement() Traceback (most recent call last): ... ValueError: Proteins do not have complements!
You can use them on Seq objects with a generic alphabet:
>>> my_seq.complement() Seq('AGTACACTGGT', Alphabet()) >>> my_seq.complement() Seq('TCATGTGACCA', Alphabet())