SeqIO
(→File Formats: Can now output "phd" files with CVS) |
(→File Formats: Adding index colum) |
||
| Line 23: | Line 23: | ||
|- | |- | ||
! Format name | ! Format name | ||
| − | ! | + | ! Read |
| − | ! | + | ! Write |
| + | ! Index | ||
! Notes | ! Notes | ||
|- | |- | ||
| Line 30: | Line 31: | ||
| 1.47 | | 1.47 | ||
| No | | No | ||
| + | | CVS | ||
| Reads the contig sequences from an ACE assembly file. Uses Bio.Sequencing.Ace internally | | Reads the contig sequences from an ACE assembly file. Uses Bio.Sequencing.Ace internally | ||
|- | |- | ||
| Line 35: | Line 37: | ||
| 1.43 | | 1.43 | ||
| 1.43 | | 1.43 | ||
| + | | No | ||
| The [[bp:ClustalW_multiple_alignment_format|alignment format of Clustal X and Clustal W]]. See also the Bio.Clustalw module. | | The [[bp:ClustalW_multiple_alignment_format|alignment format of Clustal X and Clustal W]]. See also the Bio.Clustalw module. | ||
|- | |- | ||
| Line 40: | Line 43: | ||
| 1.43 | | 1.43 | ||
| No | | No | ||
| + | | CVS | ||
| The [[bp:EMBL_sequence_format|EMBL flat file format]]. Uses Bio.GenBank internally. | | The [[bp:EMBL_sequence_format|EMBL flat file format]]. Uses Bio.GenBank internally. | ||
|- | |- | ||
| Line 45: | Line 49: | ||
| 1.43 | | 1.43 | ||
| 1.43 | | 1.43 | ||
| + | | CVS | ||
| This refers to the input [[bp:FASTA_sequence_format|FASTA file format]] introduced for Bill Pearson's FASTA tool, where each record starts with a ">" line. Resulting sequences have a generic alphabet by default. | | This refers to the input [[bp:FASTA_sequence_format|FASTA file format]] introduced for Bill Pearson's FASTA tool, where each record starts with a ">" line. Resulting sequences have a generic alphabet by default. | ||
|- | |- | ||
| Line 50: | Line 55: | ||
| 1.50 | | 1.50 | ||
| 1.50 | | 1.50 | ||
| − | | [http://en.wikipedia.org/wiki/FASTQ_format FASTQ files] are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq" refers to Sanger style FASTQ files which encode PHRED qualities using an ASCII offset of 33. See also the incompatible "fastq-solexa" and "fastq-illumina" variants. | + | | CVS |
| + | | [http://en.wikipedia.org/wiki/FASTQ_format FASTQ files] are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq" (or the alias "fastq-sanger") refers to Sanger style FASTQ files which encode PHRED qualities using an ASCII offset of 33. See also the incompatible "fastq-solexa" and "fastq-illumina" variants. | ||
|- | |- | ||
| fastq-solexa | | fastq-solexa | ||
| 1.50 | | 1.50 | ||
| 1.50 | | 1.50 | ||
| + | | CVS | ||
| [http://en.wikipedia.org/wiki/FASTQ_format FASTQ files] are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq-solexa" refers to (early) Solexa/Illumina style FASTQ files which encode Solexa qualities using an ASCII offset of 64. See also what we call the "fastq-illumina" format. | | [http://en.wikipedia.org/wiki/FASTQ_format FASTQ files] are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq-solexa" refers to (early) Solexa/Illumina style FASTQ files which encode Solexa qualities using an ASCII offset of 64. See also what we call the "fastq-illumina" format. | ||
|- | |- | ||
| Line 60: | Line 67: | ||
| 1.51 | | 1.51 | ||
| 1.51 | | 1.51 | ||
| + | | CVS | ||
| [http://en.wikipedia.org/wiki/FASTQ_format FASTQ files] are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq-illumina" refers to recent Solexa/Illumina style FASTQ files (from pipeline version 1.3+) which encode PHRED qualities using an ASCII offset of 64. For ''good'' quality reads, PHRED and Solexa scores are approximately equal, so the "fastq-solexa" and "fastq-illumina" variants are almost equivalent. | | [http://en.wikipedia.org/wiki/FASTQ_format FASTQ files] are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq-illumina" refers to recent Solexa/Illumina style FASTQ files (from pipeline version 1.3+) which encode PHRED qualities using an ASCII offset of 64. For ''good'' quality reads, PHRED and Solexa scores are approximately equal, so the "fastq-solexa" and "fastq-illumina" variants are almost equivalent. | ||
|- | |- | ||
| Line 65: | Line 73: | ||
| 1.43 | | 1.43 | ||
| 1.48 / 1.51 | | 1.48 / 1.51 | ||
| + | | CVS | ||
| The [[bp:GenBank_sequence_format|GenBank or GenPept flat file format]]. Uses Bio.GenBank internally for parsing. Biopython 1.48 to 1.50 wrote basic GenBank files with only minimal annotation, while 1.51 onwards will also write the features table (see [http://bugzilla.open-bio.org/show_bug.cgi?id=2294 Bug 2294]). | | The [[bp:GenBank_sequence_format|GenBank or GenPept flat file format]]. Uses Bio.GenBank internally for parsing. Biopython 1.48 to 1.50 wrote basic GenBank files with only minimal annotation, while 1.51 onwards will also write the features table (see [http://bugzilla.open-bio.org/show_bug.cgi?id=2294 Bug 2294]). | ||
|- | |- | ||
| Line 70: | Line 79: | ||
| 1.47 | | 1.47 | ||
| No | | No | ||
| + | | CVS | ||
| This refers to the IntelliGenetics file format, apparently the same as the [[bp:Mase_multiple_alignment_format|MASE alignment format]]. | | This refers to the IntelliGenetics file format, apparently the same as the [[bp:Mase_multiple_alignment_format|MASE alignment format]]. | ||
|- | |- | ||
| Line 75: | Line 85: | ||
| 1.43 | | 1.43 | ||
| 1.48 | | 1.48 | ||
| + | | No | ||
| The [[bp:NEXUS_multiple_alignment_format|NEXUS multiple alignment]] format, also known as PAUP format. Uses Bio.Nexus internally. | | The [[bp:NEXUS_multiple_alignment_format|NEXUS multiple alignment]] format, also known as PAUP format. Uses Bio.Nexus internally. | ||
|- | |- | ||
| phd | | phd | ||
| 1.46 | | 1.46 | ||
| + | | CVS | ||
| CVS | | CVS | ||
| [[bp:PHD_sequence_format|PHD files]] are output from PHRED, used by PHRAP and CONSED for input. Uses Bio.Sequencing.Phd internally. | | [[bp:PHD_sequence_format|PHD files]] are output from PHRED, used by PHRAP and CONSED for input. Uses Bio.Sequencing.Phd internally. | ||
| Line 85: | Line 97: | ||
| 1.43 | | 1.43 | ||
| 1.43 | | 1.43 | ||
| + | | No | ||
| An alignment format. Truncates names at 10 characters. | | An alignment format. Truncates names at 10 characters. | ||
|- | |- | ||
| Line 90: | Line 103: | ||
| 1.48 | | 1.48 | ||
| No | | No | ||
| + | | CVS | ||
| A "FASTA like" format introduced by the National Biomedical Research Foundation (NBRF) for the [[bp:PIR_sequence_format|Protein Information Resource (PIR)]] database, now part of UniProt. | | A "FASTA like" format introduced by the National Biomedical Research Foundation (NBRF) for the [[bp:PIR_sequence_format|Protein Information Resource (PIR)]] database, now part of UniProt. | ||
|- | |- | ||
| Line 95: | Line 109: | ||
| 1.43 | | 1.43 | ||
| 1.43 | | 1.43 | ||
| + | | No | ||
| The [[bp:Stockholm_multiple_alignment_format|Stockholm alignment format]] is also known as PFAM format. | | The [[bp:Stockholm_multiple_alignment_format|Stockholm alignment format]] is also known as PFAM format. | ||
|- | |- | ||
| Line 100: | Line 115: | ||
| 1.43 | | 1.43 | ||
| No | | No | ||
| + | | CVS | ||
| [[bp:Swissprot_sequence_format|Swiss-Prot]] aka UniProt format. Uses Bio.SwissProt internally. | | [[bp:Swissprot_sequence_format|Swiss-Prot]] aka UniProt format. Uses Bio.SwissProt internally. | ||
|- | |- | ||
| Line 105: | Line 121: | ||
| 1.48 | | 1.48 | ||
| 1.48 | | 1.48 | ||
| + | | CVS | ||
| [[bp:Tab_sequence_format|Simple two column tab separated sequence files]], where each line holds a record's identifier and sequence. For example, this is used by Aligent's eArray software when saving microarray probes in a minimal tab delimited text file. | | [[bp:Tab_sequence_format|Simple two column tab separated sequence files]], where each line holds a record's identifier and sequence. For example, this is used by Aligent's eArray software when saving microarray probes in a minimal tab delimited text file. | ||
|- | |- | ||
| Line 110: | Line 127: | ||
| 1.50 | | 1.50 | ||
| 1.50 | | 1.50 | ||
| + | | CVS | ||
| [[bp:Qual_sequence_format|Qual files]] are a bit like FASTA files but instead of the sequence, record space separated integer sequencing values as PHRED quality scores. A matched pair of FASTA and QUAL files are often used as an alternative to a single FASTQ file. | | [[bp:Qual_sequence_format|Qual files]] are a bit like FASTA files but instead of the sequence, record space separated integer sequencing values as PHRED quality scores. A matched pair of FASTA and QUAL files are often used as an alternative to a single FASTQ file. | ||
|- | |- | ||
Revision as of 16:47, 15 September 2009
This page describes Bio.SeqIO, the standard Sequence Input/Output interface for BioPython 1.43 and later. For implementation details, see the SeqIO development page.
There is a whole chapter in the Tutorial (PDF) on Bio.SeqIO, and although there is some overlap it is well worth reading in addition to this WIKI page. There is also the API documentation (which you can read online, or from within Python with the help command).
Contents |
Aims
Bio.SeqIO provides a simple uniform interface to input and output assorted sequence file formats (including multiple sequence alignments), but will only deal with sequences as SeqRecord objects. There is a sister interface Bio.AlignIO for working directly with sequence alignment files as Alignment objects.
The design was partly inspired by the simplicity of BioPerl's SeqIO. In the long term we hope to match BioPerl's impressive list of supported sequence file formats and multiple alignment formats.
Note that the inclusion of Bio.SeqIO (and Bio.AlignIO) in Biopython does lead to some duplication or choice in how to deal with some file formats. For example, Bio.Nexus will also read sequences from Nexus files - but Bio.Nexus can also do much more, for example reading any phylogenetic trees in a Nexus file.
My vision is that for manipulating sequence data you should try Bio.SeqIO as your first choice. Unless you have some very specific requirements, I hope this should suffice.
File Formats
This table lists the file formats that Bio.SeqIO can read and write, with the Biopython version where this was first supported. The format name is a simple lowercase string. Where possible we use the same name as BioPerl's SeqIO and EMBOSS.
| Format name | Read | Write | Index | Notes |
|---|---|---|---|---|
| ace | 1.47 | No | CVS | Reads the contig sequences from an ACE assembly file. Uses Bio.Sequencing.Ace internally |
| clustal | 1.43 | 1.43 | No | The alignment format of Clustal X and Clustal W. See also the Bio.Clustalw module. |
| embl | 1.43 | No | CVS | The EMBL flat file format. Uses Bio.GenBank internally. |
| fasta | 1.43 | 1.43 | CVS | This refers to the input FASTA file format introduced for Bill Pearson's FASTA tool, where each record starts with a ">" line. Resulting sequences have a generic alphabet by default. |
| fastq | 1.50 | 1.50 | CVS | FASTQ files are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq" (or the alias "fastq-sanger") refers to Sanger style FASTQ files which encode PHRED qualities using an ASCII offset of 33. See also the incompatible "fastq-solexa" and "fastq-illumina" variants. |
| fastq-solexa | 1.50 | 1.50 | CVS | FASTQ files are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq-solexa" refers to (early) Solexa/Illumina style FASTQ files which encode Solexa qualities using an ASCII offset of 64. See also what we call the "fastq-illumina" format. |
| fastq-illumina | 1.51 | 1.51 | CVS | FASTQ files are a bit like FASTA files but also include sequencing qualities. In Biopython, "fastq-illumina" refers to recent Solexa/Illumina style FASTQ files (from pipeline version 1.3+) which encode PHRED qualities using an ASCII offset of 64. For good quality reads, PHRED and Solexa scores are approximately equal, so the "fastq-solexa" and "fastq-illumina" variants are almost equivalent. |
| genbank | 1.43 | 1.48 / 1.51 | CVS | The GenBank or GenPept flat file format. Uses Bio.GenBank internally for parsing. Biopython 1.48 to 1.50 wrote basic GenBank files with only minimal annotation, while 1.51 onwards will also write the features table (see Bug 2294). |
| ig | 1.47 | No | CVS | This refers to the IntelliGenetics file format, apparently the same as the MASE alignment format. |
| nexus | 1.43 | 1.48 | No | The NEXUS multiple alignment format, also known as PAUP format. Uses Bio.Nexus internally. |
| phd | 1.46 | CVS | CVS | PHD files are output from PHRED, used by PHRAP and CONSED for input. Uses Bio.Sequencing.Phd internally. |
| phylip | 1.43 | 1.43 | No | An alignment format. Truncates names at 10 characters. |
| pir | 1.48 | No | CVS | A "FASTA like" format introduced by the National Biomedical Research Foundation (NBRF) for the Protein Information Resource (PIR) database, now part of UniProt. |
| stockholm | 1.43 | 1.43 | No | The Stockholm alignment format is also known as PFAM format. |
| swiss | 1.43 | No | CVS | Swiss-Prot aka UniProt format. Uses Bio.SwissProt internally. |
| tab | 1.48 | 1.48 | CVS | Simple two column tab separated sequence files, where each line holds a record's identifier and sequence. For example, this is used by Aligent's eArray software when saving microarray probes in a minimal tab delimited text file. |
| qual | 1.50 | 1.50 | CVS | Qual files are a bit like FASTA files but instead of the sequence, record space separated integer sequencing values as PHRED quality scores. A matched pair of FASTA and QUAL files are often used as an alternative to a single FASTQ file. |
With Bio.SeqIO you can treat sequence alignment file formats just like any other sequence file, but the new Bio.AlignIO module is designed to work with such alignment files directly. You can also convert a set of SeqRecord objects from any file format into an alignment - provided they are all the same length. Note that when using Bio.SeqIO to write sequences to an alignment file format, all the (gapped) sequences should be the same length.
Sequence Input
The main function is Bio.SeqIO.parse() which takes a file handle and format name, and returns a SeqRecord iterator. This lets you do things like:
from Bio import SeqIO handle = open("example.fasta", "rU") for record in SeqIO.parse(handle, "fasta") : print record.id handle.close()
In the above example, we opened the file using the built-in python function open. The argument 'rU' means open for reading using universal readline mode - this means you don't have to worry if the file uses Unix, Mac or DOS/Windows style newline characters.
Note that you must specify the file format explicitly, unlike BioPerl's SeqIO which can try to guess using the file name extension and/or the file contents. See Explicit is better than implicit (The Zen of Python).
If you had a different type of file, for example a Clustalw alignment file such as 'opuntia.aln' which contains seven sequences, the only difference is you specify "clustal" instead of "fasta":
from Bio import SeqIO handle = open("opuntia.aln", "rU") for record in SeqIO.parse(handle, "clustal") : print record.id handle.close()
Iterators are great for when you only need the records one by one, in the order found in the file. For some tasks you may need to have random access to the records in any order. In this situation, use the built in python list function to turn the iterator into a list:
from Bio import SeqIO handle = open("example.fasta", "rU") records = list(SeqIO.parse(handle, "fasta")) handle.close() print records[0].id #first record print records[-1].id #last record
Another common task is to index your records by some identifier. For this we have a function Bio.SeqIO.to_dict() to turn a SeqRecord iterator (or list) into a dictionary:
from Bio import SeqIO handle = open("example.fasta", "rU") record_dict = SeqIO.to_dict(SeqIO.parse(handle, "fasta")) handle.close() print record_dict["gi:12345678"] #use any record ID
The function Bio.SeqIO.to_dict() will use the record ID as the dictionary key by default, but you can specify any mapping you like with its optional argument, key_function.
Finally the function Bio.SeqIO.to_alignment() can be used to turn a SeqRecord iterator (or list) into an alignment object - provided all the sequences are the same length:
from Bio import SeqIO handle = open("opuntia.aln", "rU") alignment = SeqIO.to_alignment(SeqIO.parse(handle, "clustal")) handle.close() for column in range(alignment.get_alignment_length()) : print "%s column %i" % (alignment.get_column(column),column)
In the future it may be possible to do this directly via the Alignment object. See also the Bio.AlignIO module for working directly with Alignment objects.
Biopython 1.45 introduced another function, Bio.SeqIO.read(), which like Bio.SeqIO.parse() will expect a handle and format. It is for use when the handle contains one and only one record, which is returned as a single SeqRecord object. If there are no records, or more than one, then an exception is raised:
from Bio import SeqIO record = SeqIO.read(open("single.fasta"), "fasta")
For the related situation where you just want the first record (and are happy to ignore any subsequent records), you can use the iterator's .next() method:
from Bio import SeqIO first_record = SeqIO.parse(open("example.fasta", "rU"), "fasta").next()
Sequence Output
For writing records to a file use the function Bio.SeqIO.write(), which takes a SeqRecord iterator (or list), output handle and format string:
from Bio import SeqIO sequences = ... # add code here output_handle = open("example.fasta", "w") SeqIO.write(sequences, output_handle, "fasta") output_handle.close()
There are more examples in the following section on converting between file formats.
Note that if you are writing to an alignment file format, all your sequences must be the same length.
If you supply the sequences as a SeqRecord iterator, then for sequential file formats like Fasta or GenBank, the records can be written one by one. Because only one record is created at a time, very little memory is required. See the example below filtering a set of records.
On the other hand, for interlaced or non-sequential file formats like Clustal, the Bio.SeqIO.write() function will be forced to automatically convert an iterator into a list. This will destroy any potential memory saving from using an generator/iterator approach.
File Format Conversion
Suppose you have a GenBank file which you want to turn into a Fasta file. For example, lets consider the file 'cor6_6.gb' which is included in the Biopython unit tests under the GenBank directory.
You could read the file like this, using the Bio.SeqIO.parse() function:
from Bio import SeqIO input_handle = open("cor6_6.gb", "rU") for record in SeqIO.parse(input_handle, "genbank") : print record input_handle.close()
Notice that this file contains six records. Now instead of printing the records, let's pass the SeqRecord iterator to the Bio.SeqIO.write() function, to turn this GenBank file into a Fasta file:
from Bio import SeqIO input_handle = open("cor6_6.gb", "rU") output_handle = open("cor6_6.fasta", "w") sequences = SeqIO.parse(input_handle, "genbank") SeqIO.write(sequences, output_handle, "fasta") output_handle.close() input_handle.close()
Or more concisely, without explicitly closing the handles, just:
from Bio import SeqIO SeqIO.write(SeqIO.parse(open("cor6_6.gb", "rU"), "genbank"), \ open("cor6_6.fasta", "w"), "fasta")
In this example the GenBank file started like this:
LOCUS ATCOR66M 513 bp mRNA PLN 02-MAR-1992 DEFINITION A.thaliana cor6.6 mRNA. ACCESSION X55053 VERSION X55053.1 GI:16229 ...
The resulting Fasta file looks like this:
>X55053.1 A.thaliana cor6.6 mRNA. AACAAAACACACATCAAAAACGATTTTACAAGAAAAAAATA... ...
Note that all the Fasta file can store is the identifier, description and sequence.
By changing the format strings, that code could be used to convert between any supported file formats.
Examples
Input/Output Example - Filtering by sequence length
While you may simply want to convert a file (as shown above), a more realistic example is to manipulate or filter the data in some way.
For example, let's save all the "short" sequences of less than 300 nucleotides to a Fasta file:
from Bio import SeqIO short_sequences = [] # Setup an empty list for record in SeqIO.parse(open("cor6_6.gb", "rU"), "genbank") : if len(record.seq) < 300 : # Add this record to our list short_sequences.append(record) print "Found %i short sequences" % len(short_sequences) output_handle = open("short_seqs.fasta", "w") SeqIO.write(short_sequences, output_handle, "fasta") output_handle.close()
If you know about list comprehensions then you could have written the above example like this instead:
from Bio import SeqIO input_seq_iterator = SeqIO.parse(open("cor6_6.gb", "rU"), "genbank") #Build a list of short sequences: short_sequences = [record for record in input_seq_iterator \ if len(record.seq) < 300] print "Found %i short sequences" % len(short_sequences) output_handle = open("short_seqs.fasta", "w") SeqIO.write(short_sequences, output_handle, "fasta") output_handle.close()
I'm not convinced this is actually any easier to understand, but it is shorter.
However, if you are using Python 2.4 or later, and you are dealing with very large files with thousands of records, you could benefit from using a generator expression instead. This avoids creating the entire list of desired records in memory:
from Bio import SeqIO input_seq_iterator = SeqIO.parse(open("cor6_6.gb", "rU"), "genbank") short_seq_iterator = (record for record in input_seq_iterator \ if len(record.seq) < 300) output_handle = open("short_seqs.fasta", "w") SeqIO.write(short_seq_iterator, output_handle, "fasta") output_handle.close()
Remember that for sequential file formats like Fasta or GenBank, Bio.SeqIO.write() will accept a SeqRecord iterator. The advantage of the code above is that only one record will be in memory at any one time.
However, as explained in the output section, for non-sequential file formats like Clustal write is forced to automatically turn the iterator into a list, so this advantage is lost.
If this is all confusing, don't panic and just ignore the fancy stuff. For moderately sized datasets having too many records in memory at once (e.g. in lists) is probably not going to be a problem.
Using the SEGUID checksum
In this example, we'll use Bio.SeqIO with the Bio.SeqUtils.CheckSum module (in Biopython 1.44 or later). First of all, we'll just print out the checksum for each sequence in the GenBank file ls_orchid.gbk:
from Bio import SeqIO from Bio.SeqUtils.CheckSum import seguid for record in SeqIO.parse(open("ls_orchid.gbk"), "genbank") : print record.id, seguid(record.seq)
You should get this output:
Z78533.1 JUEoWn6DPhgZ9nAyowsgtoD9TTo Z78532.1 MN/s0q9zDoCVEEc+k/IFwCNF2pY ... Z78439.1 H+JfaShya/4yyAj7IbMqgNkxdxQ
Now lets use the checksum function and Bio.SeqIO.to_dict() to build a SeqRecord dictionary using the SEGUID as the keys. The trick here is to use the python lambda syntax to create a temporary function to get the SEGUID for each SeqRecord - we can't use the seguid function directly as it only works on Seq objects or strings.
from Bio import SeqIO from Bio.SeqUtils.CheckSum import seguid seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"), lambda rec : seguid(rec.seq)) record = seguid_dict["MN/s0q9zDoCVEEc+k/IFwCNF2pY"] print record.id print record.description
Giving this output:
Z78439.1 P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA.
Random subsequences
This script will read a Genbank file with a whole mitochondrial genome (e.g. the tobacco mitochondrion, Nicotiana tabacum mitochondrion NC_006581), create 500 records containing random fragments of this genome, and save them as a fasta file. These subsequences are created using a random starting points and a fixed length of 200.
from Bio import SeqIO from Bio.SeqRecord import SeqRecord from random import randint #There should be one and only one record, the entire genome: mito_record = SeqIO.read(open("NC_006581.gbk"), "genbank") mito_frags=[] limit=len(mito_record.seq) for i in range(0, 500) : start=randint(0,limit-200) end=start+200 mito_frag=mito_record.seq[start:end] record=SeqRecord(mito_frag,'fragment_%i' % (i+1),'','') mito_frags.append(record) output_handle = open("mitofrags.fasta", "w") SeqIO.write(mito_frags, output_handle, "fasta") output_handle.close()
That should give something like this as the output file,
>fragment_1 TGGGCCTCATATTTATCCTATATACCATGTTCGTATGGTGGCGCGATGTTCTACGTGAAT CCACGTTCGAAGGACATCATACCAAAGTCGTACAATTAGGACCTCGATATGGTTTTATTC TGTTTATCGTATCGGAGGTTATGTTCTTTTTTGCTCTTTTTCGGGCTTCTTCTCATTCTT CTTTGGCACCTACGGTAGAG ... >fragment_500 ACCCAGTGCCGCTACCCACTTCTACTAAGGCTGAGCTTAATAGGAGCAAGAGACTTGGAG GCAACAACCAGAATGAAATATTATTTAATCGTGGAAATGCCATGTCAGGCGCACCTATCA GAATCGGAACAGACCAATTACCAGATCCACCTATCATCGCCGGCATAACCATAAAAAAGA TCATTAAAAAAGCGTGAGCC
Writing to a string
Sometimes you won't want to write your SeqRecord object(s) to a file, but to a string. For example, you might be preparing output for display as part of a webpage. If you want to write multiple records to a single string, use StringIO to create a string-based handle. The Tutorial (PDF) has an example of this in the SeqIO chapter.
For the special case where you want a single record as a string in a given file format, Biopython 1.48 added a new format method:
from Bio import SeqIO for record in SeqIO.parse(open("ls_orchid.gbk"), "genbank") : print record.format("fasta")
The format method will take any output format supported by Bio.SeqIO where the file format can be used for a single record (e.g. "fasta", "tab" or "genbank").
Help!
If you are having problems with Bio.SeqIO, please join the discussion mailing list (see mailing lists).
If you think you've found a bug, please report it on bugzilla.